 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| ciRS-7 | |||
| Gene | CDR1 | Organism | Human |
| Genome Locus | chrX:139865339-139866824:+ | Build | hg19 |
| Disease | Hepatocellular Carcinoma | ICD-10 | Hepatocellular Carcinoma (HCC) (C22.0) |
| DBLink | Link to database | PMID | 27614453 |
| Experimental Method | |||
| Sample Type | Tissues | Comparison | 108 pairs of HCC and their matched non-tumor tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TCAACTGGCTCAATATCCATGTC ReverseACCTTGACACAGGTGCCAT | Statistics | Fold Change : Downregulated pvalue : <0.05 |
| Citation | |||
| Xu, L, Zhang, M, Zheng, X, Yi, P, Lan, C, Xu, M (2017). The circular RNA ciRS-7 (Cdr1as) acts as a risk factor of hepatic microvascular invasion in hepatocellular carcinoma. J. Cancer Res. Clin. Oncol., 143, 1:17-27. | |||